Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565515
Length 738 bp
Fasta Format > rwhms10f18
ataacagagaatcccacaacgctctcccttatttattctacacggaggat atatgtcccctatcacttccaaacgactaggacaacaattggtgaaatgt ggatcacagcattagctctggaaacagatcaaaacttgaagcaaccaatt cttgatgagaatgtccgcccactcacatccacgccatcatgacagaagcg ccgttctccgagttaccaacagggcctgtgtggtttccgccgcgagaaag cagcgccagcagcccgccgccatgcaccctgccctccggcaatggaggct ccgactgcatcgaaacaggatcaaccttcactgctgcagcaacttccatc tcgtcgggtttaacatctgtggcgaagtggtggatcacagggcctaatgt accaccaccatgaacacagtggtcctggactagagcggtgtgagctgaac agaggccagtcttgctgcgagcaaatttatcacactgctctgtgccaata ccgaagctcgagtccggcaggccccatgagcagcgcttgcctcccccgtg cgccttgcagaaatcagtgctcccctgcgcactcttcacacagccgtcga acctgcatctcttgccaccaccatggcgcacacagtactccgtccgccct ctagcactcttggtgcaatcagaaatagcgcacctcttcccaccaccgtg cgcaacacagtactgcgtcccgccatgcacgctcttgg
Download
page-top