Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565514
Length 604 bp
Fasta Format > rwhms10f16
ctcataattaactgaatccaacataacataacaaaggcatagcagctatg caggcaaaaagtagacaaccttgatgtcctgagataacatcctatcacac cggtctgaaatacaactttcacaaaattttccttcagtagaaaaagccta gcactttgccaccaacgttcttcctcctggcttcctcgtgatccatgatg ccagcagaggttgtcaggacgatgtagccaaactgacgagatggaaggag cctggcggtccatccctcgatctccttgacaccaacatcaaagcgggggc tgatgactccacacttgttcagtctgccgttcaactccacaacaatcttg ccagatctgtggtcatcaacatactcaaactcaccaatgtaaccgtgctt ctgcatgacgatgaggaacttgatgatcacttttgaggagggcctgatca tcacctgcctcttgccacgcttctcagcgttgtacatgctcttgagagca tcgttcaggacgctaaccctcaccatccttgcctaacctcgtgggggaga gaagcggggagctctctgctttggtggggtggcggcggggaggcgagggc gagg
Download
page-top