Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565508
Length 718 bp
Fasta Format > rwhms10f09
cgagggagcgaaagaatggcaaccttcacttaaatgtctccaaaactgga ctgcggcgtcaaacggtcgtctcaaaaactgattagtgggggcacaacaa gagtcaatctatagttctgtactttttacagcctttcagccctcagaagc ctttccctggccttctgctcttccatttcgttcatccaatccgaaatctg gtagacgcctttccaaataactagtcccagcaccaccaatccagctaacg cagttatcaccacgagataccacttgattcgctgccacattgaaacctga acaggttcctgtgctccgcggtcacgcttcttcctacgtttgggcacgtt tgcgacttctgcagcagggttcttattctcctgaactttccgttgatgta actctgcagctggaacattgacctttttcacacaatctccaccacatgca attaggccaactccaaactggccttttgctacttcttttgggtcacgacc agaccttcggtactccttgagaacatcttgacatacccactcttttttca gggtgttgcatgcacaacgtacattaacctttttcatgcactgatccact gacgggcattgaccagggtgacatatttctgagcacagtgggggcaattt ggtagtttcctatgacacgggccaccgcaggacctcactttcagctgttg cttggcatttaagttgtt
Download
page-top