Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565502
Length 463 bp
Fasta Format > rwhms10e24
tttgtccgggcttcattgcccagaacggtgaaaaaaaggatgcctcggac tgatgtttattcctgtatgaatggtatttacccccattatgaatgtccta ctgccttacacaggatcctggttccgacggagctgtgcggccatatccag ccagcggcgctgcagcgacccctctctcattcagcaagcacctgaagtgt gccaatcttgcagtgaccgccgttgtgtccttcgcgagcttctcaacggg agtccatagccgctctgcagctgctgcagcacgaggccaaatggtttgtt gaatgtcagatgcatctatgtgttctccccacatgcatacttctccgcca agaatcaacttctgttgctctgggttgtagatatttgtcaatggttcatt catatagaatccttcccatgtagcatccaggtgatctaggtaccacttat cctggttgctgac
Download
page-top