Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565501
Length 714 bp
Fasta Format > rwhms10e23
aggggagctacaagcctcattcatacacacttggaaaaccagcgaaaagg agcatgcatcgcgatgtgcggctgttctgggtggagacgagagtttctaa agagcggaaggtttcatttattcaaaacatccagaggagcagctgccctt cgaatgtggatttacgccaggcatgagtaggccaacgccttctcctctga cagctcctgggcggtcgcatccatcttcttcctcgagaactcatcgatcg ggagcccttgaacaattgtccattcaccaccactgcacgttactgggaag gagtagataagaccagcaggcacaccgtatgaaccatcagagtacacacc catggaaacaaatgttccctcagcggttcccagaacccagtcacggatgt gatcacaagctgagctggcagcagagagagcactggagagcttcctcgct ttgatgattgcagcaccacgctgctggacagtggcaatgaactccccatt tagccattcatcatcttgaacaagttcacgaacaggcttctctccactgg gagtcttcacagtggcatggttaacatcaggatactgactggacgagtga ttaccccagataatagcattcttaacgtcagaaacttggacaccaagtct ctcagaaatctgaccgagtgccctgttgtggtctaggcgggtcaaacaac tgatgttcttctca
Download
page-top