Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565499
Length 711 bp
Fasta Format > rwhms10e21
aacgccacccactagacagaccagaaagccctcgtccagaagccacacgg ctacacaaatgatatcagaaacgcagcaccaccaatccagcatgtcaaag accccctaaatacaacatcacatctaccatccatagaatagaaccgacgc acggttttcttatgtttcctctatactagggatcaatcaactgaactaaa gtaagcaacattttcaccgtgccagcaagacagaccagactatacaattc ttcatgtcaaggactcatcaggataccaaattcgtcgacgggatttgaag cacgagagagcaggggcaggaagacgtgcctagttgtcacacgccctaaa cagagtcagcaggcccaggaacagattgatgatgtcaaggtagagcgtga cggcagcccagacatacttgtcatacttgtaacgcttgatgatgctgccc gtgtcatagacaatgtagccactgaagatgagtgccgccagcgcgccata gatcatatgagagagcttgcccagcgggaagaagatctgaatgaacccaa agacgagcaaaatcatcagagaagcaaataggaaaggaccaaggaagcta aagtccttgcccctccttgcagcccagaaggtgtaagcagtgaggctcaa gacaactacgattgtaagaatcccagcctccaaaatgaccttgccgctag tgaaggcacat
Download
page-top