Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565495
Length 754 bp
Fasta Format > rwhms10e14
tatgcgctgatgctgccaatgattattacagacgattcttcagcttgact gcaatgctggtaaaacttttccaaggacaagaatgcgaggattattcagg agccttaaacggtgtctcaacacccaaggaaatcgaggtgcctgccactt acctactcaggctaaagctcccggtatgcaacaaaattaggtgggagaca aataatcgagagaaagagcagctggtgctcagatatgatcgcaaactgct tttgtgtagtctgacgttgatgacttcccaccaagatcagcggttctgta cttcccctcggcaattgtctggaggatggcattgtggatccggtctgctt ggtcattgaattgcaagtggcgcaacatcataacagcactcaacataaga gcagttgggtttgcaaggttcttgccagagatatcaggtgcagaaccatg aacagcctctgccagacaaatgccaccttcaccaatgttgcagctgggag ttaagcccaagcctccaatcaaaccagcacatagatcactaataatgtca ccatacagatttggcatcactaatacatcaaatgtaccaggattcttcac gagtgtcatgcagcaattgtcaataatgacttcctcatatgtgatttcag ggtacttctcagctacttcacggcaacacttgaggaaaagtccatctgtt ttcctcatgatattagctttatgtatcgcanagaccctctccctgccatt ggct
Download
page-top