Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565494
Length 758 bp
Fasta Format > rwhms10e12
ctacactcattttccttcacagctaatacatagtagtacaatacgtttta ttgctcttattcctgttgaagctccgcagctgccctcgagcacagttcga aagtagctagcttgtcaacggctgcaatacgagcaagcctggtagtggat tagtagccggcgaaaagacaggatgatcacaggtatgtaggacataggca cttgcttatatgtcagctccatcgcaggtcctactcttagcgagtagcct tacttttggcctcgcttaacatcttcttgatctcactgctgtcagggtcg agtctcagcgcctcctggaacgcatcaactgccctttggtgatcctccat gaaaatgagagctgagccctctcggtaccatgccttggaccaaccaggac gcagcattttgcaccgttgagcgtctgccagtgctctgtccccttctcgc atgcgcagccagcagaggctccggttagcaaacagggtcgcatcaagtgg gtctatctccatcaccagtccatagtagtacattgctgtaaagtagtcct tctttgcaaatgcttccttcccttgtgacttcaaatcagctttccgttct tctgcagaagctctatcctgaaccctggtctgtggagatttcatagttgt aattatcccatcaacactccaatcaggcacagatggaattgggtttgtct taggaaacagaagctcaacaagttcacgttgaccacggactgctgctctc ttgattgg
Download
page-top