Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565491
Length 753 bp
Fasta Format > rwhms10e07
agtcttttttttcgaacggaacatagtacaagtctgacccttctccttgg aatgcacatgcactctaaatcctggaagaggtaatatggatgtccttttg aaacgcatgtcttctcggtgagaccgaaaggaaaataaagacactcaatc gctggatcatgcgaagcattttcgtctccatctctcaacttctgatgctg attcagaaagtctcctcttaagaatagacttctctgcttcacagctctct acatcaatatcataatagtatgtcgacagaatctcaatgcgctcaattgg cattacaaaaatgccttctttatgggttggcaggcgctctagttttctta atgtatcgtcacccttagtcaccctcccaaatacagcatactggccatca aggtggggagcatcaccaaggaggatagaaaaggaagaggaggcactgtc tgggtcagaataccttcccattgagagtattcctctgacatgcttgacag tactaaattcaccaacaattgatttctctgcctgttgttcctgctcttta ttcataggggcttttctacctcccatgacatcggcaacttgcgcaacgaa acccttgtcaacccggaagaagtgatttgtattatagcatccaagctgca caagtttaaaaatgtgttcaactgtcttaggtgcaacatgaggaaagaag ccgaattcaatgtcaccatgatttaactggaagacgacgcgggcggatcc gag
Download
page-top