Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565489
Length 447 bp
Fasta Format > rwhms10e05
atatttganatgaacccaaagaatcntaacttcaggaatacaagaaaatc ngtactaacatccacacncaaggggaaaccanaaaggagaacaaacgatg nctataaccataggatttgatcctaaagtagatccatagaggcgctcatg catcgcgagtttatttgaatcgcaaacaaacaggcactccttgtatgtga taataagaagtcacaagagttacatancgctatggtcgcgtacttcttcc aatcttcgatcgctgaggaccggttatgacannagaaggcacaaaggtaa aagaatgactttctctgtgaaagtcngcacatccttcantactccttctt gccaaanntcttgcaccaaagctgggatgggattggccggactgggtggt gcgggcgttgctcnagctcggcggatttcatggcgatggggatgcag
Download
page-top