Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565487
Length 664 bp
Fasta Format > rwhms10e02
taaaaattaatggaagcaaactcgcaaaataaaaagatactccacgcacg agacgcaccacacgtacgtactcatgccaatgagtgcaccgcagatcact cgtatagtcgtatcacagacaggtactataggcaccagcacaaaccatag tatgaacgccgggacgtcgatcgatcactgcttgtcgttggcctcggtgg cggcggcggcagcagggtcgtcctcgtcggcgaaggcggcggcggggaag gagcgaccgatgccgacgttggacttgaagtagaccttgtcggcgccgtc gaggctcatctcgacgatgggcacccagagcatcatctgcttgctccgga ccccggtcatccgcttcatccgcccttcctccacgtacgccgtcacctcg gcgtcgtagcgcacccgggtgcccgtggcgcggaagtggtgctcgtaggg cttcccctgccgcatccacacgtagccggtctcccgcaccagcccgcact cgtccagcccgcgcagcggcatcaccccgcccgggaaccccagccccttg aggagctccttggagtgctcgtancacgcctcggcgcctgtgatgatctc cgcgccctcncgctgcttgttggcgttnccngncnncnntgtcntctcct cnnnnnnaattcnt
Download
page-top