Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565484
Length 661 bp
Fasta Format > rwhms10d20
agcacgacttacacaggatgtaaccattgtccacacctagtttagcaccg gtacaagcacacagattcagaaactaatagtagtactaacatcctagaag taaaacgcaacacctaggcaacatttaactgaacacgctactacacagaa ctggatacagccgagcacccacgaccaccgaggagtcgtcatctagctat cgtcgtcggcagccacggccttgctgcctccggccttcttggggagcaga aggttgtggatgttgggcatgacaccaccgctggcgattgtgaccatgcc gagcaggcgggagagctcctcgtcgttgcggacggcgagctggatgtggc gcggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggccaac tccagaacctcagcggcgagatactcgagcacggcggcgaggtagacggg ggcgccggcaccgaccctctcggcgtacttgccggccttgaggaaccgcg cgatcctgccgacggggaactggagcccagccttggagctcctggagatg gccttcttggcagcgcccgagccgatcgccttgccccttccggccatgtc tacagtgcttggaggggatccgcggttgtgaaatggaaaacgaggcgccg ggaggaagtgc
Download
page-top