Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565475
Length 719 bp
Fasta Format > rwhms10d05
gtctgcttcacactggtacagtgacggtgggcgcgggagtgcacatgcaa aagtgcccctcctccatatcccaccgacgtattcaagacacacatgcacg acgacgcctacatgacacccgatgacccaaccttaattaatcaaaaacct cctcagtagtacccatgcaaaacgatccatggtagtacaaataccaaatc aagccaatgcatgcatgattccaaatgatgagttcagttcagcagcttca gctgtactggacgatggaacggtagaaggtgctgggcgcccagttggccg ggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgc atggagaagggcgcctggaggcggtggccggagtccagccgccagataga cccccatgactcgcgcatcggcgtccacgtcccggagttggcctccatga ggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagcacc gcgaagtacaccgggttcgacccctgctccacgtggaacgtcaccttgag accggggaactcgcacggcactctcttgaactggatgtcgatgatgcccg agtggcggagcttctcgctgaggccgggcttggccatggcgccnaaggcg gtgccactcaggtcnaagtggtacttggcaaccgggtantanttcatgtc ngtgatgacaccgtctccg
Download
page-top