Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565464
Length 706 bp
Fasta Format > rwhms10c08
cactttgcggctggccggcgttcaccatacaagcaaacgggctctccgaa cagacagcatgatcacgatggtcgatggaccataagaaaatgagagcata agttgccatcacgaagagcgacctctgactaagtaacgcccaagtattca tcgttctcatttctcatggagcaacacacaggctacatccaggacatgaa gcaagcgggcagatcaaaccatttccccaaagatccttgtaatttacacc atgatgttacaatttgaaccacccattatgtgtgcagttcaccgcagttg ccttgatatatggctacaactcgcagctagcgagcgccaacgcctcactt gccggggacaaagtttgtggcaaacgcccatgcgttgttgttgacagagt cggagaggtggtcagcgaggttctcgagtgggcccttgccggtgacgatg gcctgcacgaagaagccaaacatagagaacatggcgaggcgaccgttctt gacttccttcaccttgagctccgcgaatgcctctggatcgtcagccaagc ccagtgggtcgaagctgcccccggggtagagtgggtcgactacctcaccg agtgggccgccagcaatgcggtacccctcaacagcgcccatgagcacgac ttggcatgcccagatagcaaggatgctttgtgcgtgcacgaggctggggt tgccca
Download
page-top