Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565459
Length 763 bp
Fasta Format > rwhms10c02
gacacacggatggatagaaagcactatcataacgcaggtcataagctagt accaatgctactagtaatagaaagactgatacaaccttaatgtaagacga tagatacagatgggtcaagtgagcgctattcgcagttgtgccacaagatt gatcctttgtgccgtctagtcttcgtcaagtagactatctttgagaatca ctcgatcacaagagcttcaacaagagcatcatcttggtcaggaacgtatg gacgatagctatcagaatccctcagcctgtcctccgggatagcaatctgt attccagtccaatcaatcttcttccattgttcggcagcgttttcgttccc cctttccctgttggcgatgagttcttcatcgacctcgtagtagcccttgt cccgcacagacgcgatgacctcctgccggtactcttcgaaatcgtcgtcc atcttcttgaaaagctctacactgtcagcgtgggcacgcttcctttcctc aatccactccagaggaaaatactctgccagatcgtccaggtaatcggcgc tggggtgttgctccggcttcagcgcaattatggtcctaatctcggctttc gacagccgaaccttgcccttgtttggacctggtggtgctgcggccggctg attggcgacggcggatgacagattcgcctccccaagcatcttgtccatcg cagtcacccccttgtctgactcgaaagactcgtcaccctccttggtagat ggatccggcggcg
Download
page-top