Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565457
Length 497 bp
Fasta Format > rwhms10b23
tacagacagagtacatcgaacgcaggtggtaaactgctgaaaccaaacac ttccagttttcaccacatggataacagagatacaggccaattcatcgttc gttcattaagcagcatcattaacatcactttccgccaaacaagtagccca gggaggagccaccgccaggagcagcatgaaccttggttgaaggacggtcc gtaaggaagttgcccgtgttctggccatctgcacggtagtagttgttcgc ccggctacctggaatgccagctggaatctgcttggctacatcagcagctg ccggtgctggtttctcagcaggtgcgggcttcgcagctggtgctgcagcg ggctttgcaggctcaccatctccaaacaggtaacccagagaactttgacc accaccagcactcccgccacgactcatcttgacttagatcgggcgccgac gaggggacggggggcgagggcgagacaggaggaggcgctcgaagtgg
Download
page-top