Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565451
Length 512 bp
Fasta Format > rwhms10b17
tttgactctgaacttgaagtgcaatgtactacattcgtctccaattgcca caggctacaaacttggcataatgtggaaatacagggcaaagcattgagat aaatcaacatgcaaaatctatttcttcttgtccgtagcaccaccaccacc agacctcatcttcctgaggacacttgacatctcctccctcttcttctttg ctctcttgtgagtaccaagcttcctcttggcgaccttgagtgcgcgcttg tcctttccaaccttaagaagctcagtgatacgcttctcatagggagcaaa tccagcgacctccctaatcaagttcctgacaaacagcaccctcttggtac ctttccccttgcggtcggacgggcgaggcggcagctcgcgcttggtgacg acgtggcccttgttgatgccgacgaagagccctgacttgggctgcaacgg cgccatggccggtctcctgctaaccttgagaatggatgcgagttaaaacc ctaagccgccgc
Download
page-top