Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565447
Length 659 bp
Fasta Format > rwhms10b10
tgatagatagattccacaagacatggttcagatcacgacattcttcggtt tgacagaaaacacaggaatcaaatcgcaaaacagcagcagcctggtaggt ttaagtgcttaaaacgtctgactatgaactactcatgaatcagagcctgg gcttaagcagcgatgaaagccttcttcccgcctccggtggttccagctgg aacaaccttcaggacattgaatctcacggttttcgacaggggcctgcact ggccaatgatgacatggtcgccttccttgactcggaagcagggggagatg tgagctgggatgttggagtgcctcttctcatacctctgatacttcttcac aaaatgaaggtagttcctgcgaacaatgatggtcctgttcatcttggcac tgtggcaggttccagctatgattctgcccctgatggcaacagttccagtg aatgggcacttcttgtcaatgtaggtaccatcgatcgcttcccttggggt cttgaaaccaaggccaacactcttccagaagcggttgccagccttgcctg gcctcttggccttgtcggcctttttcgtgctgaggaaaacctttggctgc ttgaggaaagacttctcggtctgctccgccatggctgcgaggtgggcgtc naggggctc
Download
page-top