Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565434
Length 718 bp
Fasta Format > rwhms10a12
tgctcgatacatccgttttagcaacaaagtagtatatggaaggcaatgaa gcatcatctatcatgtatagttgtctcaactctgaacgatctgtcctctc ctcccctggtctgcccagcgtccatgcatcctcgatcggtccttcgttcg tactactcctagtattttctgctgtgggagagggagatatctgtcgacga cggaactgacaggaaagaaaagggcagcagacacccaaaggcggcggggt cagatgggcggcgggtcgtcccactgcaggacggcggtgtcgaggttctg ctcccgcttgagcttgtccttgaggaaccagtcgcacacccgcccggcgt tgagctcctccatcgccaccccctcctgctccgagatcacccgcagcagg ttcagcgacgagatggtgagccggcagaggaagcgctcgtgggtgctgag cccggacatctccaccagcccggcctcctccaggctcaggaacgtcctct tctccttctcttgcttcttcttcttctcgccgccatcaccgctctgctgc tgctgctgcttctcttcctggcatctcctcctcactgccgtccgcgacgc cgccgctcccgccctcgctggattgcaaaggaaagctcgtcggagcgacg gcccgggcagcgggagcgccgccaccatgtgctgctgctgctgcatgata nctaacgangttcctggc
Download
page-top