Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565430
Length 380 bp
Fasta Format > rwhms10a07
attatttgctatttgcaagaaatacttagatgtaggacgatatgatgtgt agtatccatcacagctgtatccttcaatccgtcgcgcagcagcagtattt attatctttgtatgaatcacaggtgctttcactcttagcatatccacgtg ctgaacaattttgccggcatagatcgattgtgcagcgtttccaaagaaag cacgatgtgaggctcctctccttcgtatccatgattcttccttctacatg agtgggcaataaagcggtagacatgataacaagagccaccaagcacatag cctgcacgctgttcttcataagcaccataaagaaaactaaagtagttagc tagctttctttctttgccctgctattgttc
Download
page-top