Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565426
Length 759 bp
Fasta Format > rwhms10a02
gtcgtagacggtccctggacagataacgtagtccagggttaaaaatgtgc actctgcataaatatccatgtaacaactaatacacggcacaaagtaggta acgttccttccaaatcctggtacaagaatgtcgaaaatgatagcagatga cagcaatgctcacatctgaatataaaatgtttgttcagtaataagcagca aaaggatgaccaccgtctccgcaaacatggggtataaggaaatactcatt ttaaagcaacaaccgtgcctctttattcttcctcctcggcctcctcgagc catttgacgaaaggctccagagctttcacgaaagattgccttcctttttg gtttgaacccttgcggaaccaaagaagtatggtatcttcagctaggacat cttgatcatacagtgatcttataatttcagggaacagcttcatcaactta gcatcctcataacactgtgtctggaccttgtatatgagttccagttctag ctttccacttgtgcaaaatgcattcataagaccagcccaagcattcacct gcctaagtgctgaattagaattttgctgctggttctttccagaccactga acagcctccatcagcacatcccacagcatgcgaacaacctctatatcagg aaatttagcatctttaacctgttgcttgacaacctcagttacttcagata tttcagcttcttcattgatcatagtggtcagagttgactttatctccttg agcttaact
Download
page-top