Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565425
Length 757 bp
Fasta Format > rwhms10a01
ggtaatgcagccgtaaccaaacatatatacaaatcgagcatctaggaaag gctgggtagtcaaacaccgaaacgtggcagccgagctgaaatcaccgata tgagctacggtcgtgactactactcagaagctataagcagatgtaaccaa atctacagatgatcgggcggtagttgtacgttaaatcatgaatactcatt ccactactcagcatgcctcttggccatcgtcttcttgagaccttttagga tcttggagaaccaaagcacattcatcacgaagattatgcaaggcgcaata agtaccagaaaatagccgaaggtgttcatcttcttaatctgatcataatg tacaaacatgtgatagaacaagtacatgaacagaattatccttgcaacca gccaagtaacaaccattgcaactccgttaacaaggtaagctttggagttc gtcattccagcaacatcaaggaaccatcttagattgattcctggtgtagt agtctcagtgatgagacccatgtatatgtatacatgtgcttccccagaaa gcatagcgtacattgtagacataagtgaaagcatgtggtggataacatac tccattccaccaagggcagggtaaagccaatatatcatggcaatgtctgt aatgaaatacccaatagagacccctaatgtaaaactggagaggcttgaac ttctaactgttactggtccatccagctggtcagaaaacatgcccgagaag aacacta
Download
page-top