Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ675094
Length 816 bp
Fasta Format > whms19m12
atgctttcacaccttcttcagtgagactggtgctgggaagcatgtccccc gtgctgtctttgttgatcttgagcccactgtgattgatgaggtgaggact ggcacttatcgccagctcttccaccctgagcagcttatcagtggcaagga ggatgcagccaacaactttgcccgtggtcactacaccattggcaaggaga ttgttgacctatgcctggaccgtatcaggaagcttgcagacaactgcact ggtcttcagggattcctcgtcttcaatgctgttggaggtggaactggctc tggccttggttctcttctcctggagcggctctctgttgactatggaaaga agtccaagcttgggttcacagtgtacccatcccctcaggtctccacctct gttgtcgagccatacaacagtgtcctgtccacccactctctccttgagca cactgatgtggctgtcctccttgacaatgaggccatctatgacatctgcc gccgctcccttgacattgagcgcccaacatacaccaacctcaacaggctc gtttctcaggtcatctcatccctgactgcttccctgaggtttgatggtgc tctgaatgttgatgtcaacgagttccagaccaacctggtgccctacccaa gaatccacttcatgctttcctcctacgccccagtgatctcagccgagaag gcttaccatgagcagctctctgttgccgagatcaccaacagcgccttcga gccttcctccatgatggccaagtgtgacccccgccacggcaagtacatgg gcctgctgcctcatgt
Download
page-top