Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ674892
Length 766 bp
Fasta Format > whms19a06
actagccgcgttctcctctgtggcacgcaacctttgtcccctctagatat agaacaacacgcctcgtccacccatacctctagaagtctagatctaggcc tgacccgtagttttctgatcgtgttcgcttcgatctcggggtaagctgag ttcggcgtccatgatttgttcctatcacccgtttgttatctgattctcag gtttctccttctgatcggcgagttggggcttgcggcgatcttggagcata gacgggaggcaagctggatctgcgcacggaagcttccgatctgaccggct ggcgtctcagatctgctgctggtctgatgctaaacggcggatctagatgt tcccggcggtctcagtatgttgcagcggcgggcccggaggggctctctcc ggcgagtacgtgggatcccgtctgctcctccaccccgtgcgacgacggcc gacggctctttgtgttgataattattcgatgctatgtcgataattattag atctaagagatcggaggtgacgtaaggtaagaagatgtagcaagcgaggt gcttgtggagaggtcggaggagagtgaaaaaaaagagatgtgaacatcta gaggcctttgccatgttgggtgcgctcgcatggcaggccgccaccataat aaagatgtttttttgtctcggggggagatcgcacgggggttatcttgttt tanccccgggttctcccccctgtgtgctggtgngctcctttgtccncacc cctcnnccgatccnac
Download
page-top