Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ675623
Length 713 bp
Fasta Format > whms20o14
gggactgttgcattctctgctggtttgcatgggtgggctttcacccttac aaacttcgctaagatgtatgcctccaagtttggagttgatgaggcgaaga tgatggagaggctttggggtgagaacttctttgacccagccacaaagaaa tggacctccaagaacactgggacagctacctgcaagagaggttttgttca gttctgctacgagccaatcaagcaaatcatcgccacctgcatgaatgatc agaaggataagttgtggcctatgttgaagaagctgggtgtgaccatgaag aatgatgagaaggacttgatgggcaaggctctcatgaagcgtgtgatgca aacttggctgcctgccagtcgtgctctgcttgagatgatgatatttcacc ttccctctccctcaaaggcacagaggtatcgtgtggagaacttgtacgag ggtccccttgatgatatatatgctaatgctatcagaaactgtgaccctga tggtcctcttatgctgtatgtctccaagatgattccagcatctgacaagg gtaggttctttgcctttggacgtgtttttgccgggagggttgcaactggt atgaaggtccgtatcatgggtcccaactttgttcctggccagaagaagga tctgtatgtgaagagtgtccagcgtactgttatctggatgggaaagaanc agagtctgttgag
Download
page-top