Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ674435
Length 713 bp
Fasta Format > whms17f06
tccctctccttccttcgagtttgcttcagccatgggtaaggagaagactc acatcaacatcgtggtcattggccacgtcgactctggcaagtcgacgacc actggccacctgatctacaagcttggaggcattgacaagcgtgtgatcga gaggttcgagaaggaagccgctgaaatgaacaagaggtctttcaagtacg cctgggtgcttgacaagctcaaggccgagcgtgagagaggtatcaccatc gatattgccctctggaagtttgagacaaccaagtactactgcaccgtcat tgatgcccctggtcaccgtgacttcatcaagaacatgatcaccggtacct cccaggctgactgtgctgttctcatcatcgactccaccactggtggtttt gaggctggtatctccaaggatggccagacacgtgagcacgccctccttgc tttcactcttggagtgaagcagatgatctgctgctgcaacaagatggacg ccaccactcccaagtactcgaaggctcgttacgaagaaattgttaaggag gtctcttcgtacctgaagaaggtcggctacaaccctgacaaggttccctt cgtccccatctctgggttcgagggtgacaacatgattgagaggtccacca accttgactggtacaagggcccaaccctgcttgaggcacttgaccagatc aacgagcccaaga
Download
page-top