Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ674286
Length 765 bp
Fasta Format > whms16m10
ccacctcccgtttccacctctctatcctatggatagagccgccgcgacag ccatagatatcctcgctatgatcccatcagcgccctctcctttgtagcac catctcccctcccccaccccacccccgggtttatttgacaagatttgatc ccaatcctcgcacgtttcttggccgagtgggggagaagattccagaaatg gctgtcgccgtagctgccgggaccctccgtacctgttccggcgtatttcc ggcggcgtccgggaaccatccgcttgccgggtggcggccacttgcaccgg cagcgcccgctaagctgagattattgtctccagctttgagggttcctaga gctgcttcgcctgcagctgttgagaatgggagctctagcaacagtaatac agtccctacaccgaaggttataatagatcaagactcagatccggatgcaa ctattgtggaagtaaccttgggtgaccgtcttggggatcttcttgatact atgagtgccttgaggaatttagggctaaatgttgtgaaagctagtgtttg cctcgattcttctggcaagcacaataagttcgctataacaaagtcgtcaa ctggtcgcaaaattgatgacccagagttgttagaagcagtaagactgaca attattaacaacatgcttgagtatcatcctgaagctagcagtcaattggc catgggtgcaacttttgggctagagccccctacggaagtggttgatgtgg acatagcaactcaca
Download
page-top