Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ674256
Length 617 bp
Fasta Format > whms16k20
agcctgttcgtgaacttgttcaagatgatgaatggctaaatggggagttc attgccactgtccagcagcgtggtgctgcaatcatcaaagcgaggaagct ctccagtgctctctctgctgccagctcagcttgtgatcacatccgtgact gggttctgggaaccgctgagggaacatttgtttccatgggtgtgtactct gatggttcatacggtgtgcctgctggtcttatctactccttcccagtaac gtgcagtggtggtgaatggacaattgttcaagggctcccgatcgatgagt tctcgaggaagaagatggatgcgaccgcccaggagctgtcagaggagaag gcgttggcctactcatgcctggcgtaaatccacattcgaagggcagctgc tcctctggatgttttgaataaatgaaaccttccgctctttagaaactctc gtctccacccagaacagccgcacatcgcgatgcatgctccttttcgctgg ttttccaagtgtgtatgaatgaggcttgtagctccccttttgcctgatga tttacaggacagtacatttgctgcaagagtgaaacaatttgacacctgat tagaatcaaaaaaaaaa
Download
page-top