Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ674002
Length 206 bp
Fasta Format > whms15m08
tggcaaggaggatgcagccnacaactttgcccgtngtcactacaccattg gnaagganattgttgacctatgcctggaccgtatcangaagcttgcagac aactgcactggtcttcagggattcctcgtcttcaatgctgttggaggtgg aactggctctggccttggttctcttctcctggagcggctctctgttgact atggaa
Download
page-top