Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ298605
Length 515 bp
Fasta Format > rwhsl25o02
gacataggcaagctttnataaatggcaagcaatagacnagacagatgaag aagcattttcgtccatttaagcttgatatactagtaaatcaaactgtaaa gatcgtcggcagaaccactgacgatgacaacgacgaccacgaccactact accgttgaaacagcagcagagacacatgtaaccccgtactacatgtgtac gttattcaaaccttnaacagagagaagcaaaggtgcgagcttgcagcgca tgtcttgccgccgcccgcgcgcgccctacggcgggcaacacatgccgcaa cacgcccagccatatatggggcaagtgcggcagttgcagtttctgtagcc gcaccacaggagccggcgtgccccgccgcccgccgccgctatctgcgtgg ccatcagcaggaccacgaggagcatcacgcaggagacgaacatcttgttc ctcagaagtgctgccatgccgccgccggaggccatcgcttcaggtggtga gagtgagacgaagtc
Download
page-top