Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ673215
Length 716 bp
Fasta Format > whms12m20
gggcccaggcgtacgactggagcgcctacaagcaggtcttcgacctggtg cacgaggccgggctcaagctgcaggccatcatgtcattccaccagtgcgg tggcaacgtcggcgacgtcgtcaacatccccatcccacagtgggttcgcg acgtcggcgccaccgaccccgacattttctacaccaaccgcggcgggacg aggaacatcgagtacctcacccttggagtggacgaccagcctctcttcca tggaagaactgccgtccagatgtatgctgattacatggcgagcttcaggg aaaacatgaagaagttcttggatgccggtaccatcgtggacattgaagtg ggacttggcccagctggagagatgaggtacccatcgtatcctcagagcca aggatgggtcttcccaggcatcggagaattcatctgttatgataagtacc tggaagcagacttcaaagcagcagcggcgaaggctggccaccctgagtgg gaattgcctgacgatgctggagagtacaacgacactcccgagaaaaccca attcttcaaggacaacggaacatacctcacagagaaggggaagtttttcc tgtcatggtactccaacaaactgatcaagcacggtgacaagatcttggac gaagcaaacaaggtcttcttgggatgcagggtgcagctggcaatcaaaat ctctggcattcactgg
Download
page-top