Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ673112
Length 671 bp
Fasta Format > whms12g08
gaagcagccgccgcccaagaaggttgagagcagcagctctgaggagcagt catccgagtccgaggaggaggaggttcctaagaagactgcaaagcctgtc aaacacgagtcttcagatgatagcagcgacgattcctcctctgacgagga acctgcaaagaagccttctgctaaacctgtgaccccagctgccagcaacg gctcaaagaaaggcaagcctgagagcagctcttctagttctgaggatgag tccgatgatgacgagaaacctgctgctctggtaaagaaaacaccagtcat cgaatctgacagctccgaaagtgactcagatgatagctcagatgaggatg ttcctgccaagactcctgctgctgctgccaagaaggtagattcttcagac agttctgagtcggagagtgaatctgaggatgaggagaagtcaaagaaagc cgcacaggccaccaagatagctcctgcagctgctaaaagaaaggaggagc ccagtgattcctcagacagtgatgagagtgatgaagagcctccccagaaa aagctgaaggatgctgcgaaggttactcctaagtctgccaaaaaggacag caccagtgatgatgacagttctgatgaaagctctgatgatgagcctaaaa agaaagttacaactgcctcaa
Download
page-top