Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677049
Length 704 bp
Fasta Format > whms7e17
agggggaaaagaaagaaaaggaaaaccaaccagaagaaaagctcgggagg agagcgtggggggactagggagcatggcggagcacaaggaggagccggtg gcggagtccatgatggacaagatctccgacaagttccacggtggggactc gtcgtcgtcgtcctcggactcggacgacgagaagaaggggtcggcggcgg gcgtcaaggccaagatctaccgcctcttcggccgcgagaagcccgtccac gccgtcctcggcggcggcaagcctgctgatcttgttctatggaggaacaa gaaggtctccggaggggtgcttgctggcgctactgccatctggctgctgt tcgaggtcatggagtaccatctgctcaccttggtgggccactgcctcatc ctctccctggcaaccctcttcctctattccaatgtctgcattttcatcca caagtctcccccgaacatccctgaggtgaaaatcccggaggacatgactg taaacattgcactatcactgcggcatgagatcaaccggggcttctttacc ttgagagagactggtcatggtcgtgatctgaagaaattcctcattgtgat tggagggctctggcttctttctgttcttgggagctactgcaactttttga cactgtcatatatagtctttgtggtgctgtacactgtgccagttctgtat gana
Download
page-top