Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ676525
Length 540 bp
Fasta Format > whms5e04
atgacaccaaattctgctgcgtaccttcctggtacacctggtggtcaacc aatgactccaggcaatgctggaatggatataatgtctcctgtaataggtg gcgagggcgaagttaactgggcattgccagatgtgttagttaatgtcttg gcggcaggtgatgaaggacctggtgtggtcagggaagtgcttggggatgg aacttgccgtgtggcacttgggtcgtcaggcaacggagacattgtgacgg tccttccgactgagctcgaggtcatcagaccaaagaagagtgacaggatc aagatcatgaatggtaccttccgcggatttgttggaaaacttataggaat agacggttctgatggcattgtgaagctcgacgacacctatgaggtcaaga tcttagatatggtgattttggccaaactggcggcttgagctggatgtata tttgtaacctgtccctcatatagcctttgttgtaacaagtgtcgttgttt tctcaataaaacatatgttatttttgtttcaaaaaaaaaa
Download
page-top