Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ676308
Length 703 bp
Fasta Format > whms4h23
acttccgtcccatcccccctccgtctctcttctctagcagccgcctcgcc ctctcgctccgtccgatctcctcccgcagcccgagaaagccgacgaggta gtcccgcacgtcggccatgggcgacagccagtactccttctccctcacca ccttcagcccgtcggggaagctggtgcagatcgagcacgcgctcacggcc gtcggatcgggccaaacctcgcttggcatcaaagctgccaatggtgtagt tatcgccactgagaagaaattgccttctattttagtggacgaaacatctg tgcagaagattcagtcactgactccaaatattggagttgtctacagtggg atgggtccagatttccgcgttcttgtcagaaaaagtcggaagcaggcaca gcagtattatcggttgtacaaggaaaccatccccgtgacccagcttgtcc gagagactgctgctgttatgcaggagttcacacaatctggtggtgtaaga ccatttggtgtatcactgttgattgctgggtatgatgacaatggtccgca gttgtatcaggttgacccatcaggatcttacttctcctggaaagcatcag cgatggggaaaaatgtgtcaaatgcaaagacatttcttgagaaaagatac accgaagatatggagcttgatgatgccattcatactgcaattttgactct gaa
Download
page-top