Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ676244
Length 606 bp
Fasta Format > whms4e13
tgcgcctccacttccatcgcctcccaagatcgcagatctgctccggtgag aatccgtcgccatgtcttccagcgaggtcgcctgcacccttgccgccctc atcctccacgatgacgggatccccatcacttctgagaagatcgcgacggt ggtgaaggctgccggaatcaaggttgaggcctactggcccgcgctcttcg ccaagctcctggagaagaggagcgtcgatgacctcatcctttccgtcgga tctggtggaggtggtgctccagctgctgctgctgctgccccggctgctgg tggtgctgctgccgctgaagagaagaaagaagagaaaaaggaggaggcta aggaagagagcgatgatgacatgggcttcagcttgttcgactaagcagtt caattccagttctcctgtggaatcttttatgctaaggattacttatctta tgtgcttttaggtcgaattttgcggatttaatatgtttgagacctaagta tctgtgcaatgagtactgcaaaccaccttgggatggtctttttagaatga aaatggttttggtgcttggttgaaaagccattgcttgttttaccctaaaa aaaaaa
Download
page-top