Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ676142
Length 752 bp
Fasta Format > whms3o06
agcggcggcgaagatggtgtcgctgaagctgcagaagcgcctggcctcga gcgtcctcaagtgcggcaagggcaaggtctggctcgaccccaatgaggtc aacgagatctccatggccaactcccggcagaacatccggaagctggtaaa ggatggtttcatcatcaggaagcctcagaagatccactccaggtctcgtg caaggagggcacatgaggccaagcagaagggccgtcactctggatatggt aagcgtaggggtaccagggaggctaggctccccaccaagatcctgtggat gcggaggatgcgcgtcctgaggcgccttctgcgcaagtaccgtgaggcca agaagatcgacaagcacatgtaccatgacatgtacctgaaggtcaagggt aacatgttcaagaacaagagggtcctcatggagagtatccacaagtccaa ggctgagaaggcaagagagaagaccctctctgatcagtttgaggccaagc gcgccaagagcaaggcaagcagggagaggaagcatgccaggagggaggag agattggctcagggccccagagatcatgcaccagcaccagcggctgcagc tccagctccagcagcagcggcaccaaagaaggccaaggccaagaagtgaa ggtctgacatgaagctttagctttctggtatcatgaagggttagcctgat tttggagcatctgaagttcanaactgttttctgtgcaatatctgtgtgcc gc
Download
page-top