Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ675158
Length 719 bp
Fasta Format > whms1a19
ctcgctccctacactccctccttgcctctacgccgccagcggtccatggg caagtcaagcaagaagtccgcggcccctactgtcgtggcgccggcggccg tccttaccaaggggaaggccgggaagaagcgcgaagccgatgacgagatc aagaaggctgtaagcgcaaagaaacagaaggctgcgccggcaaaggcggt gcccgggcccaaagaggccgccaagaaggccaagaagcagccgccgccca agaaggttgagagcagcagctctgaggagcagtcatccgagtccgaggag gaggaggttcctaagaagactgcaaagcctgtcaaacacgagtcttcaga tgatagcagcgacgattcctcctctgacgaggaacctgcaaagaagcctt ctgctaaacctgtgaccccagctgccagcaacggctcaaagaaaggcaag cctgagagcagctcttctagttctgaggatgagtccgatgatgacgagaa acctgctgctctggtaaagaaaacaccagtcatcgaatctgacagctccg aaagtgactcagatgatagctcagatgaggatgttcctgccaagactcct gctgctgctgccaagaaggtagattcttcagacagttctgagtcggagag tgaatctgaggatgaggagaagtcaaagaaagccgcacaggccaccaaga tagctcctgcagctgctaa
Download
page-top