Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672707
Length 702 bp
Fasta Format > whms10o06
cctcctcctaaaccactctccctatccccgtgtccagaatctaccccccg gctccaatggcggcgaaggaaccgatgcgcgtgctcgtcaccggcgccgc aggacaaatcggatatgctcttgttcccatgattgccaggggagttatgc ttggtgcagaccagcctgttattctgcatatgctggatattgaatttgct gctgaagctcttaaaggcgtcaagatggagttgatcgatgccgcatttcc acttctcaagggagttgttgcaacaactgatgttgttgaggcttgcactg gtgtgaatgttgcggttatggttggtggattccccaggaaggaaggaatg gaaaggaaggatgttatgacgaaaaatgtttcaatctacaaagctcaagc atctgctcttgaagctcatgcagcccccaattgcaaggttttggttgttg ccaacccagcaaacaccaatgctctcatcctgaaggagtttgctccatct atccctgagaagaacatcagttgtttgacccgcctagaccacaacagggc actcggtcagatttctgagagacttggtgtccaagtttctgacgttaaga atgctattatctggggtaatcactcgtccagtcagtatcctgatgttaac catgccactgtgaanactcccagtggaganaancctgttcgtgaacttgt tc
Download
page-top