Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672557
Length 662 bp
Fasta Format > whms10g03
caggcgaaggaggccaagccggaggtcgaggccaagtcaaaggaggtcaa ggccaaggtggagttgaggaccctcaccaaggaggaggaggaggcgctca tcaagttcgtggcgctgctggagaaggaggaggacttcctcgacgccaag gcggaggcggagaaggaggcggagaagtgtggctccaagaggaaggtgga gttggagcgggatgaggagggggcagcgttcctggcgtggatcgagtcca ccaagccacagacggaccaagtggattactcggatggggatgtgtcggac ggctaccactcgcaggacgacaacatcggcagcgacggcagggtcatgtc gcggtatgagcgccatgttcaggccaacaacgctcgctgtcctttcttgg tgggggcctaatcccatccacgacggtgctcttgctcttgtggtctgaga agctgacgaggagcttcgccattgctatcccatctagtaccaaccatgta tctatcttatctatctatatttctagttgatcctgtggacatatatatgt gggattgatccgcctaccctgatgctattgttgcgcaccgatgaagcaat gtcattgtgagactgataatctatcgagtactantantatctagtatatg ttaaaaaaaaaa
Download
page-top