Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672556
Length 653 bp
Fasta Format > whms10g02
atggctctgaggctgtgggcaagctcagctgccaatgccctcaagatttc aagcagcggcgccagggccgctgccccggcctactcgatctccagatact tctccaccgttattgatggcttgaagtacacttcctcccacgagtgggtc aagaacgacggctccgtggccacgattggcatcagtgaccacgcccaggg ccatctcggggaggtggtgttcgtggagctgccggagaccggcacgaagg tgagccagggtggggccttcggcaacgtggagagtgtgaaggccaccagc gacgtcaactcgcccatctccggcgaggtcgtcgaggtcaattcgaagct gtccgagaccccgggcctgatcaactcgagcccgtacgaggaggggtgga tgatcaaggtgaanccgagcancccggcggagctgganggcctgctggac tcngccaagtacaccaagcactgcnaggaggangacncccactantgctc ccttgttcncttatcaatccttttgctgcaaccatatcnaatactcttgt ctacaataattaaaccancttcaccatgcnttcanttcatcnnntccaat tttcttntgtnnnnntanatgnnnnncannactttnttatannatttnnn nna
Download
page-top