Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672555
Length 604 bp
Fasta Format > whms10g01
tcctgcagcatctcggctcacaaaggtgacagagttaaagttcactaccg tggaacacttaccgatggaacagttttcgattctagctttgaaaggggtg acccgattgaatttgaattgggcactggtcaagtgatcaaaggatgggat cagggaattttgggcatgtgcattggtgagaagaggaagctgaagatccc ttcaaagctcggctatggggatcagggatcaccacctaccattccaggcg gagcaactctcatattcgacacagagcttgtcgctgtcaatggcgagcca tctagcaaatcagaggaggatgacgctgatctgtaggcagctcggcgcag cacgatcgcccagttatcaaatcgaataggactatgtatgggaaacttac tcttgtagggcagacacaatgaggcaggaacattgtcttaccatgatcaa acagaggagcctagttctcaaaatcgaatagatcaagtgacttttgttac cctatgtaattctctggaataattctcctatctaccttgttacttttgct tttgttcttggaatggttataaagtactactcccttcatttctcaaaaaa aaaa
Download
page-top