Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672554
Length 716 bp
Fasta Format > whms10f24
actcgcctgccttccttccttccttgttcgttcctcgacgcacgcacgca gatctcatccatccaagccaaggcaggtcaggtcaggtacgagatggctc tcaccagaattggtctcgctggcctcgcggtcatgggccagaaccttgcc ctcaacattgccgagaaaggcttccccatctctgtctacaacaggacaac gtccaaggtcgatgagactgttcagcgtgccaagctagaaggaaaccttc ctctctatggtttccatgaccctgcatcctttgtcaactccattcagaag ccacgtgtcgtcatcatgcttgtcaaggctggtgctccggtcgaccagac catcgcaacgctcgcagcacacctggagcaaggtgactgcatcgttgacg gaggaaacgagtggtatgagaacacagaaaggagggagaaggccatggag gagcgtggactcctctacttagggatgggtgtctccggaggagaggaggg tgcccgccatggcccctccatgatgcctggaggctcactggaggcttacc agtacattgaagacattcttctcaaggtgtctgctcaagtccctgacagc ggtccgtgtgtcacatacattgggaagggtgggatctggaaactttgtca agatggttcacaatggtatcgagtacggtgacatgcagctgatcgctgag gcatatgatgttctca
Download
page-top