Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672551
Length 672 bp
Fasta Format > whms10f20
ttgtggagtcggcttcacttgaaccaaagtctggcagcaaattcattgct ggaggagaagatatgtgggttcatgtatttgatttccttactggtgaaga aataacttgtaacaaagggcatcatggtccagttcactgcgtccggtttg cacctggtggtgaatcatacgcctcagggtcggaagatggtactattcgg atctggcagctgagcccacctaacgcggatgctgaggaggcgatcgatac aaatggtaagcccaaggctggagcagaggagattgcgtgtaagattgaag gcttccacattgccaaggaggagaaggccggggagtaggattacatcgtt ggatgagatgctgttgttatcctcaaagctgctctttccgtcttgccttg cgtctgttcgtcaaagccggtgtccgacgcaagtgtggctggcttgtatg agtagttaactgcgccgtgggaaaaatcttgcccttcatcgagcaaatgc tggggattttttggtacaccgaaaataagccaagagtanaacattttgtg gatgaggtgttgatcangattanattganatgccattgtgtattttgtgt tgacacatttttgtcccacccttttgtgttgactatgatanacnaaatgg tgttgttttggttgaaaaaaaa
Download
page-top