Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672545
Length 769 bp
Fasta Format > whms10f13
atttccctcacaccctcaccccgcagcccatttgccccctgaccaagccg ccgccgccgccatctccggccaccccgcctctcccccctctccctccccg gcctcgccgccgccgacccataccggaacaggaggaccgccaccgccgta aagcctccgtgccagctgcctccccgtcggccacgctgcaaccagagcaa gatcccgcccctggtcgcatctcagaatggcgaccctgaggaacctgaag atcaagacgtcgacgtgcaagaggatcgtcaaagagctgcgctcgtacga gaaggaggtggagaaggaggccgccaagaccgccgacatgaaggagaagg gcgccgacccctatgatctcaagcagcaggaaaatgttttagctgagtcg aggatgatggtcccagactgccataagcggcttgaagctgcactgacaga cttgaaagcaactctggccgagttgaaggagtcaaatgaacaaggcactg agatcggtgaggctgaggctacaatcactgaagttgaagctgtctacacg ccaacagaagctgaagattaagctcgcaacttccttttcgctgaaatgtc agtatgcatcaccagacttgctcttgtcgacaagttagtcccattcatat gatgttgacgcgaaagcttgtatgtatcacgactcatgatctgtctcgag atgtgcaactggtaatatcactgtactggaatatggttaggcgtttatga tgtgctggaaatgctgcat
Download
page-top