Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672535
Length 726 bp
Fasta Format > whms10e23
gaatctaccccccggctccaatggcggcgaaggaaccgatgcgcgtgctc gtcaccggcgccgcaggacaaatcggatatgctcttgttcccatgattgc caggggagttatgcttggtgcagaccagcctgttattctgcatatgctgg atattgaatttgctgctgaagctcttaaaggcgtcaagatggagttgatc gatgccgcatttccacttctcaagggagttgttgcaacaactgatgttgt tgaggcttgcactggtgtgaatgttgcggttatggttggtggattcccca ggaaggaaggaatggaaaggaaggatgttatgacgaaaaatgtttcaatc tacaaagctcaagcatctgctcttgaagctcatgcagcccccaattgcaa ggttttggttgttgccaacccagcaaacaccaatgctctcatcctgaagg agtttgctccatctatccctgagaagaacatcagttgtttgacccgccta gaccacaacagggcactcggtcagatttctgagagacttggtgtccaagt ttctgacgttaagaatgctattatctggggtaatcactcgtccagtcagt atcctgatgttaaccatgccactgtgaagactcccagtggagagaagcct gttcgtgaacttgttcaagatgatgaatggctaaatggggagttcattgc cactgtccagcagcgtggtgctgcaa
Download
page-top