Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672530
Length 413 bp
Fasta Format > whms10e16
tatcctgaaggtcggtgaaggagccgctgcccagtgcatcagtggattca cagccatggacatcccccctccccgtggtcctctctggatcctgggagac gtcttcatgggcccctaccacaccgtcttcgactacggcaagctgcgggt cggcttcgccaaggcggcctgaaggggtgatcgagcgagcgccccatcgt ggaggcgaacacttgcgccgggaaagagcttagcttttttactctgaatt tgaccggtgatgtgtgtgtatatatgctacatgctgcttttcaaaagacc ctgacatgactaagggtggttcctaagatggctgagactgtttctggatg tttgttccgacaatgttgttgaattagtatgtgataaacaacgtttacct tctaaaaaaaaaa
Download
page-top