Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672529
Length 715 bp
Fasta Format > whms10e14
tggcaccctttttgctccctttcccatccccatctttcgtccacccctcc cccctctcgccgcggaccccatccgccgcccgccgccgccgccgttgaca ctacccgcgaatctccttcttccgagtggtggagaggagacatggcactc cggaggctgcttcaggggattgtcctaccgcggacgacgggccggcatgt tggggcatcgttttccacggaggctggggagactatccgcgcaaccctgt ttcctggtgatggcatcgggcctgagatcgccgagtcggtcaagcaggta ttcaatgttgcaggtgtaccgatagaatgggaagaacattatgttggtac ggaagttgatcccagaacagagagctttttgacatgggagagcctggagt cggtgcgtagaaacaaagttggcttgaaaggtcctatggctacacctatt ggaaaaggccaccgttctttgaatcttacattaaggaaagaacttggact ctacgccaatgtcagaccttgcaacagcctcccaggctacaagactagat atgatgatgtgaaccttgtgacaatccgtgaaaatactgaaggagagtat agtggccttgagcatcaggttgtgaggggtgttgtggaaagtttgaaaat tattacccgccaagcaagtttgagagtggcagagtatgctttccattatg ccaaagccaatggca
Download
page-top