Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672525
Length 711 bp
Fasta Format > whms10e07
tcgccgccgctctccttttcctcctcacggccgcttcgaccgccggcgct tccacttattacgcctcggatcccaacctcggatccgcccgcgtcgtctt ccagttaaatcatggtgacattgaattcggcttctttcctcatgttgcac ctaagacagttgaacacatttttaaacttgtgcagcttggatgctataat acaaatcacttcttccgggttgacaagggtttcgttgcgcaagttgccga tgtcatgggaggtagaaaagcccctatgaataaagagcaggaacaacagg cagagaaatcaattgttggtgaatttagtactgtcaagcatgtcagagga atactctcaatgggaaggtattctgacccagacagtgcctcctcttcctt ttctatcctccttggtgatgctccccaccttgatggccagtatgctgtat ttgggagggtgactaagggtgacgatacattaagaaaactagagcgcctg ccaacccataaagaaggcatttttgtaatgccaattgagcgcattgagat tctgtcgacatactattatgatattgatgtagagagctgtgaagcagaga agtctattcttaagaggagactttctgaatcagcatcagaagttgagaga tggagacgaaaatgcttcgcatgatccagcgattgagtgtctttattttc ctttcggtctc
Download
page-top