Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672524
Length 716 bp
Fasta Format > whms10e06
agctttttcaggcaagttattggcgctccaaagaagaaaacccttgcatc tatatttcctgtggcaaaaatggatggtgttgttagtcctgaactaacaa aatattttgaagtacaaatgtctcagcaggaaaaacctgatgtctcccag tcagttcctctttatgaaaagcttagagagtcatttgaaactggtgaagt aaattgccatatatctggagatttgaaggatgacaaacagaccaataatt ttgatgatattgatgggccagacaccccgaatgatccatatgttgacatg gatattgatgatgacatgccaagttactcagataagattgatgatgacgt ggttcgagttacgcaggacagcatggatggacataaaagccttgatgatt tgtgtcgatcacatctggatgctctccttgctagcatagctgaggctgaa caacaaaccgagctggatgcacgagtttcaacatggaaagagcgaataga gcttgccttggaagagcaggatagaaacccaccctttgatattggtttat atggagagcagatccttgacacactctcgtcaagaactgatacagggatt gcatcattcagtgagattgttagcagcaaaccaaagtacgaggttgcaag aacattctctgcccttctccagctggtgaacggcagaagtgttgatctgg acaaaggacaagctac
Download
page-top